Cell Biology Problem
*
5'- ATGCTATCATTGACCTTGAGTTATTAA -3'
i) Is this a strand of DNA or RNA? How do you know?
ii) If DNA, what is the complementary strand?
iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?
iv) If this were the noncoding strand of a DNA molecule, what would the mRNA sequence be?
v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)
vi) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!)
vii) What would happen to the reading frame if three bases were inserted/deleted? Why?
- Plain text response
- Your Information is Secure
- Best Online Academic Help Service
- Students find real academic Success
- Reading Genes - Is this a strand of DNA or RNA? How do you know? If DNA, what is the complementary strand? If this were the coding strand of DNA molecule,what would the mRNA sequence be? If this were the non ...
- If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? - *5'- ATGCTATCATTGACCTTGAGTTATTAA -3' 1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: thi ...
- How are these two types of mutations likely to affect the protein coded for by a mutant gene? - Assume that protein synthesis always reads along a chromosome three bases at a time to code for each successive amino acid in a protein. There are two kinds of point mutations, a base substitution, an ...
- Comaparing the structure and synthesis of proteins and nucleic acids. - What are four similarities in the polymeric structure and synthesis of proteins and nucleic acids?
- cell biology DNA gene reading - 5'-ATGCTATCATTGACCTT*GAGTTATTAA - 3' If DNA and the G were deleted at the asterisk (third G from left) how would this affect protein synthesis and the resultant protein?
