Biology Homework Solutions
#264319
Reading Genes
Is this a strand of DNA or RNA? How do you know?
If DNA, what is the complementary strand?
If this were the coding strand of DNA molecule,what would the mRNA sequence be?
If this were the noncoding strand of DNA molecule,what would the mRNA sequence?
If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (code)
What would happen to the reading frame if three bases were inserted/deleted? Why?
If DNA and the G were deleted at the asterisk, how would this would would this affect protein synthesis and the resultant protein?(code!)
Answers to a series of questions on genes and transcription. Web references provided.
What is this?
By OTA - Overall OTA Rating
Michelle Knowlton, PhD - 4.9/5
Purchase Cost Now
$2.19 CAD (was ~$11.97)
Included in Download
- Plain text response
Why you can trust BrainMass.com
- Your Information is Secure
- Best Online Academic Help Service
- Students find real academic Success
- Cell Biology Problem - * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding str ...
- cell biology DNA gene reading - 5'-ATGCTATCATTGACCTT*GAGTTATTAA - 3' If DNA and the G were deleted at the asterisk (third G from left) how would this affect protein synthesis and the resultant protein?
- If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? - *5'- ATGCTATCATTGACCTTGAGTTATTAA -3' 1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: thi ...
- Determining the complementary DNA and RNA sequence given a DNA sequence. - For the DNA sequence 3'TTTAAAGGGCCC5' determine: 1) the complementary DNA sequence 2) the RNA sequence and the peptide sequence
- Understanding nucleic acids, DNA, RNA, transcription - Given the DNA sequence shown below, what is the complementary sequence in (a) DNA and (b) mRNA? 5'AAGGTCAGCTAGGGACTTTTCCCAGGTC-3'
