Biology Homework Solutions
#264404
cell biology DNA gene reading
5'-ATGCTATCATTGACCTT*GAGTTATTAA - 3'
If DNA and the G were deleted at the asterisk (third G from left) how would this affect protein synthesis and the resultant protein?
Translation of an mRNA sequence with a deletion mutation.
What is this?
By OTA - Overall OTA Rating
Michelle Knowlton, PhD - 4.9/5
Purchase Cost Now
$2.19 CAD (was ~$3.99)
Included in Download
- Plain text response
Why you can trust BrainMass.com
- Your Information is Secure
- Best Online Academic Help Service
- Students find real academic Success
- Reading Genes - Is this a strand of DNA or RNA? How do you know? If DNA, what is the complementary strand? If this were the coding strand of DNA molecule,what would the mRNA sequence be? If this were the non ...
- If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? - *5'- ATGCTATCATTGACCTTGAGTTATTAA -3' 1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: thi ...
- Cell Biology Problem - * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding str ...
- Biology Terms and Concepts - What are Endoplasmic Reticulum and what do they do?
- What is environmental Biology? - What is environmental Biology?
