Biology Homework Solutions
#2654
Understanding the sequence in protein synthesis.
Which of the following illustrates the correct sequence of events in the synthesis of a protein molecule?
DNA + RNA formation of a polypeptide in RNA
Formation of polypeptide + RNA in RNA DNA
RNA in RNA DNA + formation polypeptide
DNA in RNA + RNA formation polypeptide
In RNA formation of polypeptide DNA + RNA
What is this?
By OTA - Overall OTA Rating
Departed OTA
Purchase Cost Now
$2.19 CAD (was ~$3.99)
Included in Download
- Plain text response
Why you can trust BrainMass.com
- Your Information is Secure
- Best Online Academic Help Service
- Students find real academic Success
- Protein synthesis - order events 1-7 so that they represent the correct sequence corresponding to steps a-g, tracing a typical secretory protein from the initial transcription of the genetic information in the nucleus t ...
- How is a protein made using a DNA sequence? - Discuss/diagram the process from gene to protein. In other words, how do you build a protein based on a sequence of DNA? Thank you!
- The process of protein synthesis. - What factors are required for protein production, starting with a DNA template?
- DNA Transcription & Replication - How does transcription differ from DNA replication? How is it the same? What is the role of complementary base-pairing in each? If a section of the DNA strand to be transcribed is CTAATGT, what is the ...
- How to remember the difference between replication, transcription, and translation - Replication, transcription, and translation are all terms used to describe DNA, RNA, and protein synthesis. It can be confusing trying to memorize these definitions because the words are similar, so ...
- Protein synthesis by cells - An mRNA can be translated by many ribosomes at the same time, creating a complex called a polysome. How might this capacity be an advantage to the cell?
- Understanding the difference(s) between prokaryotic and eukaroytic messenger RNA. - What are the major difference(s) between prokaryotic and eukaryotic messenger RNAs?
- The translation of secreted proteins. - Why is translation of a secreted protein stopped by SRP?
- DNA transcription and translation. - The following DNA sequence is on the template strand of a DNA molecule being transcribed: T A C C G A T G A C C G A T T A.What is the complementary RNA strand that is formed? B.Assuming this ...
- cell biology DNA gene reading - 5'-ATGCTATCATTGACCTT*GAGTTATTAA - 3' If DNA and the G were deleted at the asterisk (third G from left) how would this affect protein synthesis and the resultant protein?
- DNA Code - Using the provided DNA code, derive the correct amino acid sequence. Describe the necessary steps to arrive at the amino acid sequence, and explain each in detail. Make sure to list the mRNA sequence, ...
- Biology - DNA sequence 3' ACTACGGCAATACGGGCTGGGCGACTGG 5' mRNA sequence 5' ? 3' What are the sequence for: START CODON & STOP CODON
- Reading Genes - Is this a strand of DNA or RNA? How do you know? If DNA, what is the complementary strand? If this were the coding strand of DNA molecule,what would the mRNA sequence be? If this were the non ...
- Protein Translation - What is protein translation? In your own words, briefly describe the steps. Where does it take place?
- A given DNA sequence is transcribed to an mRNA sequence. Three nucleotide bases from the mRNA sequence are used to form codon, which code for anticodons in tRNA, also called transfer RNA. tRNA adds amino acids to polypeptide chains forming a protein. - The nucleotide sequence of a DNA codon is GTA. In an mRNA molecule transcribed from this DNA, the codon has the sequence ___. In the process of protein synthesis, a tRNA pairs with the mRNA. The nu ...
- Some characteristics of mRNA. - Name 5 features of mRNA that can regulate its stability or translation. Indicate whether the feature regulates stability or translation.
- Molecular Genetics Translation - Please indicate which statements correctly apply. In molecular genetics, TRANSLATION -refers to the use of DNA as a template to code for RNA -refers to the use of RNA as a template to code for pr ...
- A short perspective on the Central Dogma - From new perspectives on old ideas comes new knowledge, this perspective presents an interesting way to view and understand the Central Dogma.
- Mitosis and Meiosis AND Gene to Protein - 1. Compare/contrast the processes and products of mitosis and meiosis. AND 2. Discuss/diagram the process from gene to protein. In other words, how do we build a protein based on a sequence of ...
- Genetics (DNA, Mutations, Cell Division, Protein Synthesis) - Complete all three parts and answer all questions. Remember to turn in Punnett Square for Part 2. Part 1: Genetics â€" From Genes to Proteins, Mutations (Chapter 10) Overview: Genetic informatio ...
- ER Targeting Signal - 1. Describe what type of ER targeting signal sequences each of the following proteins would need for proper translation and localization: A) A protein that functions in the lumen of the ER B) An in ...
- Comaparing the structure and synthesis of proteins and nucleic acids. - What are four similarities in the polymeric structure and synthesis of proteins and nucleic acids?
- Biology - 1. Explain why a well-adapted organism synthesizes only the proteins necessary at any particular moment. 2. When radioactive uracil is injected into the developing larvae of Drosophilia, only certain ...
- Genetics, Genes, Proteins, Mutation, Punnett Square - Complete all three parts and answer all questions. Remember to turn in Punnett Square for Part 2. Part 1: Genetics â€" From Genes to Proteins, Mutations Overview: Genetic information in DNA is t ...
- DNA is examined. - In your own words. How does DNA affect the cell? How is the DNA apparatus like an elaborate machine?
