Biology Homework Solutions
#156066
If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein?
*5'- ATGCTATCATTGACCTTGAGTTATTAA -3'
1) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!)
2) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!)
3) What would happen to the reading frame if three bases were inserted/deleted? Why?
What is this?
By OTA - Overall OTA Rating
Stephen Allen, MSc - 4.9/5
Purchase Cost Now
$2.19 CAD (was ~$3.99)
Included in Download
- Plain text response
Why you can trust BrainMass.com
- Your Information is Secure
- Best Online Academic Help Service
- Students find real academic Success
- Reading Genes - Is this a strand of DNA or RNA? How do you know? If DNA, what is the complementary strand? If this were the coding strand of DNA molecule,what would the mRNA sequence be? If this were the non ...
- Cell Biology Problem - * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding str ...
- cell biology DNA gene reading - 5'-ATGCTATCATTGACCTT*GAGTTATTAA - 3' If DNA and the G were deleted at the asterisk (third G from left) how would this affect protein synthesis and the resultant protein?
- Intracellular molecule synthesis is examined. - Ttwo intracellular moleules, A and B, are normally synthesized at a constant rate of 1000 molecules per second per cell. Each molecule of A survives an average of 100 seconds, while each molecule of ...
- ATP Synthesis - How does the mitochondrion couple the fall of the electrons in the electron transport chain to ATP synthesis?
