Gene linkage

Eye color in Drosophila depends on the synthesis of two pigments, a red pigment and a brown pigment, resulting in the wild-type (WT) dull red eye color. Mutations blocking production of the brown pigment result in bright red eyes, while mutations blocking production of the red pigment result in brown eyes. If both pathways are ...continues

Gene linkage

The following cross involving three genes was performed: Aa Bb Cc x aa bb cc, and the phenotypes and number of progeny are shown below. Each pair of alleles exhibits simple dominance and recessiveness. Progeny Phenotype Number of progeny A B C 181 a b c 169 a B ...continues

Hybridization experiment involving complimentary gene

You cross two true breeding strains of zucchini, one with green fruit and the other with yellow. The F1 plants are all green , but when these are crossed, the F2 plants consists of 9 green and 7 yellow. How many genes are involved in determining the zucchini color? Using your own symbols, designate which genotypes yield green an ...continues

DNA template strand

A portion of an exon of a eukaryotic protein-coding gene has the following sequence on the template strand: 5'-AGTCAAGCATCCCTTA-3' What is the sequence of the non-template strand written in the 5'-3' orientation? What is the sequence of the corresponding region of the mRNA? , what is the amino acid sequence of the corres ...continues

Expected number of random fertilization in plants for given hybridisation

What will be expected number of possibilities for random fertilization if the following two plants were hybridised? AaBbCcDd x AABbccDd

Imprinted Gene

Imagine that for a maternally imprinted gene, allele a encodes an inactive version and allele A is the wildtype version. Do you expect the following individuals to exhibit an abnormal phenotype? Why or why not? a) a female of genotype Aa in which the wildtype allele came from her father? b) a male of genotype Aa in which the wil ...continues

Restriction enzyme

The restriction enzyme ECOR I cuts DNA leaving 5' overhangs, Pst I leaves 3' overhangs after cutting DNA and SMA I leaves blunt ends on the fragments it produces.Indicate wheter DNA ligase can join the following pieces of DNA. a) a fragment of human DNA that was generated by cutting with Ecor I and a plasmid DNA that was also c ...continues

Transcripts

Eukaryotes may regulate gene expression at any number of levels. Imagine that transcripts of gene A are found only in the developing liver and transcripts of gene B are found only in the developing eye. List a general type of cis-regulatory sequence difference that could explain the expression difference between the two genes ...continues

Calculate base pairs (Dna fingerprinting)

In exercise 9 of my lab manual which i attached i need someone to take my distances and calculate base pairs and put it on the graph on page 81. Also tell me which suspect matches the crime scene. My distances are Hind II=20mm,23,25,30,38,39, Crime scene=33,35,52, Suspect 1=37,48,50, s2=27,32,35,41,46, s3=30,33,36,50, s4=37,47, ...continues

PCR

You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction: 5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3' Assume (unrealisitcally) that you will use 5 nucleotide long primers positioned to amplify the entire sequence. a) What are the sequences of the two primers you would use? ...continues