Transcription

The human beta-globin polypeptide is 146 amino acids long. How long is the coding portion of the human beta-globin mRNA?

Transcription

The primary transcript or pre mRNA of a nuclear gene in a chimpanzee has the sequence 5'-G-exon1-AGGUAAGC-intron-CAGUC-exon2-A-3' After the intron has been excised, what is the most likely sequence of the mRNA?

Translation from synthetic nucleotides can produce more than one polypeptide

Suppose you were to construct a synthetic RNA from a repeating dinucleotide AGAGAGAGAG and then use it as a messenger to synthesize a polypeptide in an invito system. What type of polypeptide would you make from this polynucleotide? Would you expect to have more than one polypeptide? Why?

lac operon

The table below lists several genotypes associated with the lac operon in E. coli. For each, indicate with a “+” or a “-” whether B-galactosidase would be expected to be produced at induced levels. B-galactosidase production Genotype No Lactose On Lactose (a) I + O+ Z+/ F’ I - O+ Z+ (b) I - Oc Z +/ F ...continues

Fingerprint - genetics

See attached file for full problem description.

Plasmid mapping

A plasmid digest with BamHI produced 2 kb and 4 kb fragments. Digest of a plasmid with HindIII produced 6 kb fragment. Double digest with both enzymes produced 1 kb, 2 kb and 3 kb fragments. Draw a plasmid map.

DNA

The restriction enzyme Scs1 cuts at a restriction site that is found only very rarely in dog genomes. One dog, Jimmy, has two restriction sites for this restriction enzyme in his genome. Another dog, Billy, has three restriction sites for this enzyme in his genome. For this problem assume there is only one chromosome in dogs. ...continues

Restriction enzymes

In the following sequence find restriction sites for EcoRI, HindIII and Hae III. Show how many fragments will be produced by restriction by all of these enzymes at the same time and their size, Which of the fragments produced will have 5'-overhang, 3'-overhang or blunt end? GAAGAACCTGAATTCAAATTTGGCCCTGCTGCTGAAGCTTGCTGACCAGG ...continues

SNP linkage

You are trying to map a human gene thought to be involved in cat allergies. Because you know this gene is on chromosome 20, you decide to examine the linkage of several SNPs located on chromosome 20 with respect to the gene involved in cat allergies. You have obtained DNA from 10 individuals and know whether they are allergi ...continues

6 questions on fruit fly genetics and matings; 6 questions on karyotypes of patients

The common fruit fly, Drosophila melanogaster, has been the subject of genetic study for over 100 years. In fruit flies, curly wings are dominant to straight wings. 1. How would you designate the genotype of a homozygous curly-winged fly? _________ 2. How would you designate the genotype of a straight-winged fly? ________ ...continues