Biology Homework Solutions
#81029
Mutations
All mutations are not "equal." TACAGACCC is a sequence of DNA which codes for a protein. Please state which mutation will cause the largest change in the protein and why.
Mutation 1 - TACAGACCC is changed to TACAGACTC
Mutation 2 - TACAGACCC is changed to TACAGGCCC
Mutation leads to change in the genetic code. Net effect of mutation is observed in the form of differential coding behavior for protein. In some cases change in codon does not have any effect in the coding output whereas in some cases it causes decisive changes.
What is this?
By OTA - Overall OTA Rating
Pankaj Kumar, PhD - 4.6/5
Purchase Cost Now
$2.19 CAD (was ~$3.99)
Included in Download
- Plain text response
Why you can trust BrainMass.com
- Your Information is Secure
- Best Online Academic Help Service
- Students find real academic Success
- Mutations are summarized. - I briefly describe how a mutation might alter gene function (at the molecular level) if it fell into the following categories. As an example, a neomorphic mutation could result from expressing a gene ...
- Understanding the universal nature of the Genetic Code. - The nearly universal nature of the genetic code supports the view that: All living organisms share a common ancestor Nucleic acids were the first living things Proteins are a secondary import ...
- How are these two types of mutations likely to affect the protein coded for by a mutant gene? - Assume that protein synthesis always reads along a chromosome three bases at a time to code for each successive amino acid in a protein. There are two kinds of point mutations, a base substitution, an ...
- Determining why there is no phenotype change after a genetic mutation. - A single base-pair mutation in the gene of a model organism has been found. However, an individual homozygous for this mutation shows no phenotype. How is this possible?
- Cell Biology Problem - * 5’- ATGCTATCATTGACCTTGAGTTATTAA –3’ i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding str ...
