Biology Homework Solutions
#10932
What is the Polymerase Chain Reaction?
The Polymerase Chain Reaction (PCR), devised by Kary Mullis in the mid-1980's has revolutionized molecular biology by allowing a whole new approach to the study and analysis of genes. i) What is PCR? ii) What are the steps involved? iii) What are the necessary reagents involved in making the PCR work?
What is this?
By OTA - Overall OTA Rating
Aaron Park, MSc (IP) - 4.5/5
Purchase Cost Now
$2.19 CAD
Included in Download
- Plain text response
Why you can trust BrainMass.com
- Your Information is Secure
- Best Online Academic Help Service
- Students find real academic Success
- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction? - 1- Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction? 2- Each of the following pairs of primers have a problem with it. Tell why the primers ...
- PCR - You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction: 5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3' Assume (unrealisitcally) that you will use ...
- Taxonomy and Molecular Biology - How has molecular biology improved our view of taxonomy? Give an example.
- Genetics - How can we amplify a segment of DNA? - How can we amplify a segment of DNA? Describe the principles of the PCR (polymerasechain reaction) method.
- Briefly discuss new developments in DNA sequencing technology. - In recent years, molecular biology has undergone a revolution that can be partially attributed to the advent of easy DNA sequencing methods (thanks to Fred Sanger's work published in 1977), and yet th ...
