Amritha De Croos, PhD
OTA ID#: 101042
| Education Experience: |
BSc Hons, Biology, Dalhousie University, 1997 MSc, Biology, Trent University, 2000 PhD, Biology, Carleton University, 2003
|
| Focus of Study: |
I am currently a post-doctoral fellow studying MAPK and cell signalling. I am pursing my research interests by studying how a stress affects the signal cascades that take place under exogenous signals. My research uses numerous biochemical techniques forcing me to stay up-to-date in biochemistry, molecular biology and microbiology. |
Outside Interests: |
Apart from science, I enjoy film, travelling and spicy foods! |
| Postings Answered: |
80 |
| Cumulative OTA Rating: |
4.5/5 What is OTA Rating? |
- The Building Blocks of Biology - Identify two different types of organisms that you have seen interacting, such as bees and flowers. Now form a simple hypothesis about this interaction. Use the scientific method and your imagination ...
- The Cardiac Cycle - In tracing a drop of blood from tissue cells of the left knee to the capillaries of the right arm including the lungs.
What are the aspects of the cardiac cycle, keeping track of the left and righ ...
- The Witting Reaction - Why is it important that any aldehyde used in Witting reaction be free of carboxylic acid impurities?
- Using the ideal gas law to answer a pressure problem. - A 75.0L steel tank at 20.00 degree C contains acetylene gas, C2H2, at a pressure of 1.39atm. Assuming ideal behavior, how many grams of acetylene are in the tank?
- Placing animals in their proper taxonomic category. - In the animal kingdom, you can place animals in categories based on certain differences in the characteristics that each possesses. If you know what critical traits to look for, it is possible to sepa ...
- DNA sequencing - The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene.
AUGUUUGCUGGGGGACAUUCGUGGGCA
(a) D ...
- The study of mitosis and meiosis-how scientists study it. - What are some of the methods that scientists have used to study the components, processes, and outcomes of cell division?
- DNA as a starting point - I am trying to figure out why a defendant's genes should be considered as a factor in the criminal behavior? Can you help me figure out some pointers and factors?
- DNA Multiple Choice/Short Answer - What is the relationship among DNA, a gene, and a chromosome?
A) A chromosome contains hundreds of genes which are composed of DNA.
B) A gene contains hundreds of chromosomes which are composed ...
- Dihybrids Crosses - In cocker spaniels, black coat color (B) is dominant over red (b), and solid color (S) is dominant over spotted (s). If two dihybrids (Bb Ss) were crossed, which would be produced?
A. black and s ...
- General Biology Questions - 1. Which type of nutritional mode requires the obtaining of nutrients from nonliving organic matter?
A. saprobic
B. parasitic
C. mutualistic
D. autotrophic
2. Which type of nutritional mode r ...
- MONOCOT v. DICOT - I am trying to understand the difference between a typical dicot flower AND a typical monocot flower. I've been searching for a simple to understand drawing that labels the sepal, stamen, pistil (dic ...
- The differences between a two chambered heart and a four chambered heart. - Explain the differences in respect to the organization and the circulatory pattern between the relatively simple two-chambered heart to the more complicated four chambered heart.
- The environmental impacts of coal, oil, natural gas, biomass, hydroelectric, nuclear, solar, wind, and hydrogen in Canada - What are the direct and indirect environmental impacts of coal, oil, natural gas, biomass, hydroelectric, nuclear, solar, wind, and hydrogen usage in Canada?
- Ecology and physiology of freeze tolerance in the wood frog Rana sylvatica - What takes place at an ecological and physiological level during the freezing and thawing process of the wood frog?
- Calculating the productivity of a continuous culture given MUmax. - A batch animal cell culture has a productivity of 1.8 g/L*day, with a MUmax=0.5 days, a 10% inoculums and a turnaround time of 5 hours. If a continuous culture could operate at a dilution rate of 90% ...
- Calculating the equilibrium constant for gases sealed in a flask. - Nitrosyl chloride decomposes according to the chemical equation below:
2NOCl(g) <--> 2NO(g)+Cl2(g)
0.600atm of nitosyl chloride is sealed in a flask and allowed to reach equilibrium. If 27.0% of ...
- Solubility of Starches - 1. Some starch/carbohydrates, although soluble in warm water, become gel like once experincing a cold atmosphere. The commercial dessert, Jell-O, is composed of just this type of starch. Making the de ...
- Striated muscle work - Would a muscle that is long and thin (ie: more series elements than parallel elements) or a muscle that is short and thick (ie: more parallel elements than series) be able to lift an object that has m ...
- What steps can/do municipalities take to protect the amount of open space that plants and animals have available? - Regardless of where we live, I imagine that all of us can remember a plot of land that is now a strip mall that used to be undeveloped, or some other area that has changed dramatically over time.
...