Online TA Profiles
Stephen Allen, MSc
OTA ID#: 104330
| Education Experience: |
BSc, Biochemistry, Dalhousie University, Halifax, Canada, 1985 MSc, Biochemistry, Baylor College of Medicine, Houston, Texas, 1987 BA, Theology, Ambassador College, Big Sandy, Texas, 1990 Graduate Certificate, Bioinformatics, University of British Columbia, Vancouver, Canada, 2000 |
|---|---|
| Focus of Study: | My graduate work in biochemistry related to identifying control and regulatory elements on human genes involved in nitrogen metabolism. |
| Awards: | I have been recognized as an outstanding educator in “Who’s Who Among America’s Teachers”. I received the March of Dimes Birth Defects Foundation, pre-doctoral research fellowship, the Aldous Prize in Pharmacology, two Natural Sciences and Engineering Research Council of Canada summer undergraduate research fellowships, and Academic Excellence Awards for highest gpa in an undergraduate program. |
| Publications: | 1. “Towards a Non-Aristotelian Epistemology of Science” ETC: A Review of General Semantics 60:228-240 (2003).
2. “Activity of Human delta-5 and delta-6 Desaturases on Multiple n-3 and n-6 Polyunsaturated Fatty Acids” FEBS Lett 509:77-80 (2001). 3. “Associations Between Central and Peripheral Measures of Phospholipid Breakdown Revealed by Cerebral 31P Magnetic Resonance Spectroscopy and Fatty Acid Composition of Erythrocyte Membranes” Prog Neuropsychopharmacol Biol Psychiatry 25(8):1513-1521 (2001). 4. “Activity and mRNA Abundance of Delta-5 and Delta-6 Fatty Acid Desaturases in Two Human Cell Lines” FEBS Lett 491(3):247-251 (2001). 5. Experiments and Investigations in Biology, Ambassador University Press, Big Sandy, TX (1995). |
| Work Experience: | Technical Director - Bio Vision Technology Inc.
2002-present I assess and advise on scientific and technological issues relating to biomass fractionation technologies, manage technical and business feasibility studies, and coordinate and write applications for grants and project funding Instructor of Mathematics and Chemistry Kings-Edgehill School 2002 I instructed Grade 10 mathematics and Grade 11 chemistry at the oldest private school in Canada. Senior Research Scientist and Project Manager - QuantaNova Canada Ltd. 1999-2001 I oversaw all bioinformatics research relating to lipid genomics in the company, initiated and coordinated integrated research projects, and imparted strategic leadership at all stages of a project. Research Associate - QuantaNova Canada Ltd. 1999 I developed and implemented research proposals and conducted experiments to further corporate research goals relating to identifying novel genes involved in fatty acid metabolism. Clinical Analysis Manager - Scotia Pharmaceuticals Ltd. 1997-1998 I managed the clinical analysis department of a medium-sized pharmaceutical firm involved in the development of photodynamic therapy for cancer and pharmacological uses for natural plant oils. Instructor in Biological Sciences - Ambassador University 1988-1997 I designed and taught a number of undergraduate courses in biology and chemistry at a liberal arts university in Texas: General Biology, Human Anatomy and Physiology, General Chemistry, Biochemistry, and Open Seminars. |
| Skills & Achievements: | I have over 12 years of direct academic teaching expertise at the undergraduate or post-secondary level and many years of corporate experience managing and directing numerous research projects. |
| Career Interests: | Above all, teaching itself is my career interest; research has been secondary. However, my research field of interest has been molecular biology of fatty acid metabolism and the use of bioinformatics to elucidate novel genes involved in lipid metabolism. Currently, I am involved in a significant project for converting woody biomass into alternative fuels and chemicals. |
| Outside Interests: | I am an accomplished violinist and conductor, having directed university choruses and community orchestras for a number of years. I very much enjoy Biblical studies, producing a newsletter for those keenly interested in exploring Biblical topics. |
| Message to Students and/or Parents: |
We may divide educators into three groups based on the idea that true education relates more to "seeing the forest" than it does to "seeing the trees". Poor educators do not understand even the "trees", and so their teaching becomes confusing and muddled. Good educators understand "trees" excellently well, yet their teaching is too complicated. A great educator, however, understands not only the "trees" but also the "forest". Because of this, he can simplify the otherwise complicated issues in the "trees" and make them easily comprehended. My wide range of skills and experience allows me to reach into the details without losing sight of the big picture. |
| Postings Answered: | 1722 |
| Cumulative OTA Rating: | 4.9/5 What is OTA Rating? |
- Determining whether certain marketing practices are deceptive or not. - Florida's Department of Citrus and a coalition of consumer groups have launched an attack on your company for "deceptive marketing" because your company markets its "SunShine" drink as fruit juice eve ...
- Ethics Theory and Business: Rights and Obligations: Drug Use and the Employer - "Drug use is information that is rightfully private and only in exceptional cases can an employer claim a right to know about such use." Defend or oppose this statement.
- Issues and Traditions within Judaism, Christianity, and Islam - What are to the top two current issues facing each of the following religions: 1) Judaism 2) Christianity 3) Islam In addition, name & summarize two sacred traditions (e.g. holidays, sacre ...
- Animals are placed in taxonomic classifications based on differences and similarities of their traits. If you know what critical traits to look for, it is possible to separate any animal into a taxonomic category. - Could you please help me with this? Examples of nine Animal Phylum: Porifera, Cnidaria, Nematoda, Arthropoda, Platyhelminthes, Annelida, Mollusca, Echinodermata, and Chordata. jellyfish, snail, ...
- Similarities and differences among Judaism, Christianity, and Islam - Help me write a summary of the similarities/differences between these three religions: Judaism, Christianity, and Islam.
- Vitamin C Content of Juices - Assignment 1 of Procedure 1 1. Calculate the molarity of the freshly-prepared ascorbic acid standard (known strength) solution: (a) Mass of ascorbic acid used:0.05g (b) Moles of asc ...
- Leadership Theories: Autocratic, Participative, and Free Rein - I am investigating major leadership theories and models. I am looking for the pros and cons of each of the following theories. I have chosen to go with Autocratic, Participative, and Free Rein as my t ...
- Cell Biology Problem - * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding str ...
- Cost Management: Discretionary vs. Committed: Reduced Budgets - Dr. Stephanie White, the Chief Administrator of Uptown Clinic, a community mental health agency, is concerned about the dilemma of coping with reduced budgets next year and into the foreseeable future ...
- Thermal Decomposition - Calculate the following: (a) moles of malachite in 1g: Cu2CO3(OH)2 Cu= 63.55 x 2=127.1 C= 12.01 O= 16 x 5= 80 H=1.008 x 2= 2.016 (b) moles of CuO produced: .72 g CuO produced ( ...
- Philosophy, Ethics, and Business Law as they pertain to DWI Inc. - Congratulations! You have just been hired by Denise Worldwide Industries (DWI), Inc., as the Vice President of Risk Management. DWI is headquartered in West Palm Beach, Florida, and has over 150 offic ...
- Healthcare Professional - Moral and Legal Stance on Abortion - Please write a position document indicating what the healthcare profession's legal and moral stance should be on abortion and why.
- Law & Ethics: Stare Decisis: Healthcare - 1.Why is law not an exact science? 2.What are the implications for healthcare? 3 Briefly describe beneficial effects to our system of law gained from the principle of stare decisis.
- Judaism Pres. - A. List a timeline for the historical development of the Jewish faith through the present day. B. List Jewish rituals, practices, key beliefs, and holy days. C. List issues for Jews today and to ...
- Mitosis and Meiosis - Explain why the process of mitosis and meiosis are both important to a living organism. When would an organism need to undergo the process of mitosis? Meisis? What would happen if meiosis did not occu ...
- Which one of these is the solute and which one is the solvent in a solution composed of - i)Which one of these is the solute and which one is the solvent in a solution composed of i) 25.0 g of silver in 5.0 g of mercury, and ii) 3.0 g of iodine (I2) in 100.0 mL of ethanol? ii)What is it ...
- Ethical Issues in Nursing Practice - 1. In the mid 1970s, a nursing educator in Idaho had contact, through a student, with a female client who had chronic myelogenous leukemia. This form of leukemia can often be managed for years with li ...
- What is the major product of dehydration of an alcohol? - 2) What is the major product of dehydration of an alcohol? 3) Why does the simplest ketone have three carbon atoms and no fewer? 4) An alcohol has an OH‾ functionality in it. Do you expect it ...
- Animals are placed in taxonomic classifications based on differences and similarities of their traits. - I am looking for something original! Animals are placed in taxonomic classifications based on differences and similarities of their traits. If you know what critical traits to look for, it is possi ...
- essay queation regarding a food manufacturers claim of having a fat free cake mix. - a food manufacturer is advertising a new cake mix as fat free. Scientists at the US FDA are testing the product to see if it truly lacks fat. hydrolysis of the cake mix yeilds glucose, fructose, glyce ...
